# Name abd-A # Matrix A| 5 10 22 36 0 11 33 18 C| 2 15 15 0 0 2 1 2 G| 13 3 0 0 0 0 0 4 T| 17 9 0 1 37 24 3 13 # Construction Info Meme was run on the footprints with fixed width 8 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "7906203" "7821226" "7555708" "1358457" "8096172" "3215512" # Footprints TTGATGTCTCC AGTAATGCGACCATTAC ACCCATTTGGCTTCCCATTTCGA TATCAATTAG ACCCAATTAGTAATAAAT TGGCCATTAA TAATGATAATTACAAAC TGATAATTGACTTT TGAAACACATAAATCTTAAGTG ACATCATAAAAATATTAAAAA TCAATTATGCGCAATTTTGC GCAAATAATTTATTATCCA GTAATTATACAAGTTAATGTTAG TGCATTTAAAAGTAAATTT CTCATATTAAATGGACGTTATG AACAGATTATGGATTAG TTACCTTAATTGCTTATATATTA TGTTCATTAAATAAAATAATTT TGAATTAGTTA TGAAATAATTTT TAGGATAAATTGTTATTATAAATTT AGTAATATTCGAAATAATAATTACATTCA GGGCATAAATTAAATACACA TTGAAAGCAATAAAGAAA TAAATAATAGTTGTGG ATAATTAAATAAT GCCGATAATTGCTGCCATGAATATATAATAAT CAACATAATCACAAAAATTACC GAAATACAAAT CGGTATGGCTTCATTACGCCG CCTTTGCATATATTTAAGCACTAATTGCGTGAAGCCATAAATCTAAA CATTTAATGCATTT TGATTAAAAATCAACATACGACAATC ACCATCTTTAATAATATTT GTTAATTTAATTTATTTC GCACATTTAACATCCATTAAG ATCCCTAATGCACTTCC # Name Abd-B # Matrix A| 1 1 6 0 7 7 6 5 C| 2 5 0 0 0 0 0 0 G| 0 1 1 0 0 0 0 1 T| 4 0 0 7 0 0 1 1 # Construction Info Meme was run on the footprints with fixed width 8 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "9491376" # Footprints TGCTCATAAAT AAACGATAATG ATTTTATTTCG GTGTCATAAAAA TTTTTATGATT GTTTTATGATC ATTTTACGGCT # Name Adf1 # Matrix A| 1 0 5 0 0 0 0 2 C| 6 0 0 6 4 0 7 0 G| 0 7 2 0 0 7 0 5 T| 0 0 0 1 3 0 0 0 # Construction Info Meme was run on the footprints with fixed width 8 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "7791801" "2105454" "2318884" # Footprints TGCCGCGGTCGCAGCGCTGCCGCTGCCGC CGCTGCTGCTGCATCCGTCGACGTCGACTGCACTCGCC GAGATCGCGTAACGGTAGATAATGAAAAGCTCTACGTAA CGCAGTCCGCAGCCGCTGA CAGCGCAGTCGGCGGCGGCGGCGCGCAGTCAGCGGTGGCAGC ATGTGCGTCAGCGTCGGCCGCAACAGCG GCACTGGCAGCGACTGCGACCGCG # Name Aef1 # Matrix A| 0 3 3 0 2 3 0 2 C| 3 0 0 3 0 0 3 0 G| 0 0 0 0 0 0 0 0 T| 0 0 0 0 1 0 0 1 # Construction Info Meme was run on the footprints with fixed width 8 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "1547943" "9463385" # Footprints GGTGCACAACTACAATGTT CGACCGCAGCAACAACACGATCTTT AAACCAACAACTAACG # Name Antp # Matrix A| 8 0 11 12 0 3 C| 0 0 0 0 0 0 G| 0 0 1 0 3 0 T| 4 12 0 0 9 9 # Construction Info Meme was run on the footprints with fixed width 6 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "8255758" "7555708" "11262224" "2903553" # Footprints ACAATTTAATTGTTTATT TAATGATAATTACAAAC TGATAATTGACTTT TGAAACACATAAATCTTAAGTG ACATCATAAAAATATTAAAAA ATTTCTTTGGCATTAATCAAAATAATTGGCGCATTTCA ACCCATAAATAATATTAA CCAACTCATAA GTTAAGTTCATTTCAA AAAAATGAATTATGATTATTGCCATGTAAAAGAG TATAATATAATAATAAAAATAATAATAATAATAATAATATAAT TACTAATAGTATATAATAATTTTAATAGTATGTTATATAAAT # Name ap # Matrix A| 1 12 12 0 4 11 C| 4 0 0 1 3 0 G| 2 0 0 1 1 1 T| 5 0 0 10 4 0 # Construction Info Meme was run on the footprints with fixed width 6 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "14701680" # Footprints GCTAAATAA CTACAATTG GGATTATTA GCTTAATGA AGCCACAATCAAGCGA CATTTTCTGCTTCA TTAACAACACA TATTTTAATTA TCAATTAGCGCA AAGATGATTGCCAA GGAATTATA AGTAATAAT # Name ara # Matrix A| 0 0 1 2 0 0 C| 0 0 0 0 0 0 G| 0 0 1 0 0 0 T| 2 2 0 0 2 2 # Construction Info Meme was run on the footprints with fixed width 6 and flanking sequence was added for footprints less than 9bp or the fixed width. # Pubmed Ids for Footprinted Sites "8620542" # Footprints TTAATTAAC ACAGAAATCAAA # Name bab1 # Matrix A| 1 6 0 2 4 2 0 3 0 0 C| 0 0 0 0 0 0 0 0 0 0 G| 0 0 0 0 1 0 0 3 0 1 T| 5 0 6 4 1 4 6 0 6 5 # Construction Info Meme was run on the footprints with fixed width 10 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "12954775" # Footprints ATACAATATATATATG GTGCACAACTATATAGATGTG TATAAATAATAATTATCTTTT GTCGTTAATAGCGTTATTAATGTTAT TTTAATTATATTTATTATTATTGTTAT TATGTTTATTATTATT # Name bcd # Matrix A| 9 8 45 47 1 1 2 5 C| 18 3 1 0 0 44 26 12 G| 3 1 1 1 16 0 3 18 T| 18 36 1 0 31 3 17 13 # Construction Info Meme was run on the footprints with fixed width 8 and flanking sequence was added for footprints less than 9bp or the fixed width. # Pubmed Ids for Footprinted Sites "9376314" "2026328" "2065664" "1348871" "9250684" "9507113" "7617036" "2911348" "8620846" "2502714" "11731230" "8443106" # Footprints TCGAAGGGATTATA TAATTAAGCATGGC CGGATTTGCA CGGATTTGCA CAAAGGATTTGTCC CTCCGGCTTATCG CAAGCCGTTTTTC TGTTAATCCG CGAGATTATT CTATAATCGC TGGGATTAGC CGAAGGGATTAG CCTTCAGAAACGGATTAAATTTTTT AAATAATCCAGCCTTAAGCATGGTGATTAAGCTTG TGACGGATTTTCCTTAAATCCCTCTGTTAATCTCCGGCTTAGAGC GAACTAAATCCGGCTTAGGATTCTTG AGTCAATCTG CAAGATTAAA AATGATCAAC CTTTAGCCTT GACAAATCGC ACTTAAGCCG CAAGACTAAT TTTTAAGCCT AAAGGCTTAAA AAAAGTCAAA GATAATCTGCAGCTTAGGTAAGCTGATCCCGCGATTAGG CGAAATCGCTGGCTTAGG GTCAAGGGATTAGA GATCGCGGATTGAGG ATTCTGGATTAGAGC AAAAAATTATG TTGGATGATC GAGCTTAGCG CAGCTTAGCA TTCTATGGGGATTACG ACTTGGGATTAAAGGTGATTA GTCATCAGATTAGC ATTTAAATCCGTTTTGA GTGGCTTAACTTTTG AAATCCGTAATCTGCT GCGAGCTTAAGTCGAG CAAGCGAGATTAGAGG TGAATCCTAAAGGCTC AACGCCTAATCTGGCT TTAAAATAATTTTATT AAAAATTATTATTAAAAACGCAATCTGAGC GAAATGCAAATATTTGTTTTT # Name BEAF-32B # Matrix A| 1 0 0 2 0 2 0 0 C| 0 2 0 0 0 0 1 0 G| 1 0 2 0 0 0 0 0 T| 0 0 0 0 2 0 1 2 # Construction Info Meme was run on the footprints with fixed width 8 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "9001253" # Footprints AAAGTCACGATATTC AACCGATAGTATCGCACACT # Name BEAF-32 # Matrix A| 0 2 0 0 0 2 0 2 C| 0 0 0 2 0 0 0 0 G| 0 0 0 0 2 0 0 0 T| 2 0 2 0 0 0 2 0 # Construction Info Meme was run on the footprints with fixed width 8 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "9819433" # Footprints AGATGCGATATTTATCGATA ACTATCGTTACTATCGATAGCT # Name bin # Matrix A| 0 4 4 4 0 5 3 2 0 4 C| 0 0 0 1 5 0 0 2 0 0 G| 0 0 0 0 0 0 2 1 5 1 T| 5 1 1 0 0 0 0 0 0 0 # Construction Info Meme was run on the footprints with fixed width 10 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "11691840" "12175492" # Footprints GAAATAGTTAGTGTAAACAAGGAGG TTGAATCGCTGGTTAAATATTTAT CAATCGCTGTAAATAAATAGGAGCCG GCCGTAAATAAACAAAGAAAT CAGTGCCTTTGTTTATAG # Name brk # Matrix A| 1 0 0 0 0 1 1 0 C| 5 4 0 0 10 0 8 5 G| 4 0 10 10 0 9 0 1 T| 0 6 0 0 0 0 1 4 # Construction Info Meme was run on the footprints with fixed width 8 and flanking sequence was added for footprints less than 9bp or the fixed width. # Pubmed Ids for Footprinted Sites "11080162" "11159914" # Footprints AGCTTGGTGGCGCCTCAA GTCTGTTTAGCGCCATG CACAAGCTGACGCCAAGTTGATGGGGGCGCCGCAG GGATTGCCCGGCGCCGACT GCCCGACTGGCACCTCG ATCTGGCGTTGCGTG CGGAGTCTCGCCAG CCGGTGGCGGCGCT TTATTACTGGCGCTATC GCCTGGCGGCGCC # Name br-Z1 # Matrix A| 12 12 9 0 14 1 11 16 C| 0 2 0 3 0 4 3 1 G| 2 3 0 0 2 9 2 0 T| 3 0 8 14 1 3 1 0 # Construction Info Meme was run on the footprints with fixed width 8 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "8062827" "8582299" "11583936" "8954742" # Footprints AATCTCTCAGAACA CAATAGAGCTGGTGATTGGT TGTATCTAATTGGCAAATGAC GTCTATGTCTAACCATCGCCACA AAATAATAAACAAAATAATAAACAAAACCACGA ATACCTTTCTATTCTGTAAATATTTGTGAAAGACAAGTTCG TTATTAATAGAAGT TGCTAATCAGTG TGAATACTAATTACT GATGATAATAGTTATAA ATATACATTTGTATCTACATACATACA TGAAAAGCTCCAAAATGCAAAAA ATATTATATTATATAGTATGTTTGT CAAGGAAGTGTTATGTTCCAAATAGGAC ACCTATTGAATTTGGATTGTTCA AGAATACTTAGTTTTATAATTCCAA TGCCAGGTCCTAACT # Name br-Z2 # Matrix A| 7 0 0 21 1 2 12 11 C| 3 15 0 0 0 5 1 4 G| 1 4 0 0 5 5 1 1 T| 10 2 21 0 15 9 7 5 # Construction Info Meme was run on the footprints with fixed width 8 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "8062827" "8582299" "12464428" "11583936" # Footprints TTTATAGTAAAAGCTCCAGACCACG AAAATGGTTGAAAACAATAGAGCTGGTGATTGGT TGTATCTAATTGGCAAATGAC TCCTAGTTGAGTCTTGTCTATGTCTAACCATCGCCACA CAAAACTATTTGATTTGCTCA ACAACTAGTACACGCAAT AAATAATAAACAAAATAATAAACAAAACCACGA ATACCTTTCTATTCTG ACTGTCCTACACTTCACGA TATTAATAGAAGTGC GTTTTTGAAGATAGTGCTAAT ACTTGATAGGCAAAA TGATAATAGTTATAA TATTAATAGTTTA ATTCGTAGGAAA GTTATTAGAGCA TGTGCTAGGGGAAGTGGGCTAGGTTG ATATACATTTGTATCTACATACATACA ATGTGGTTACATAGCCAAG GGAGACTTTGCTAAAAATTTACTG ATATTATATTATATAGTATGTTTGT # Name br-Z3 # Matrix A| 7 12 10 1 0 7 0 0 C| 3 1 0 11 0 0 0 0 G| 3 0 6 0 1 3 10 1 T| 3 3 0 4 15 6 6 15 # Construction Info Meme was run on the footprints with fixed width 8 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "8062827" "8582299" "11583936" # Footprints TTTATAGTAAAAGCTCCAGACCACG CAATAGAGCTGGTGATTGGT TCCTAGTTGAGTCTTGTCTAT CAAAACTATTTGATTTGCTCA ACAACTAGTACACGCAAT AAATAATAAACAAAATAATAAACAAAACCACGA GTAAACTAAAGCTGGTGC TGTGAAAGACAAGTTCG TCAACAAGTTTATCAT CGCTTACTTTTAGTTTCTTCA AATGCAGTGGGTATATAAAG AAGATAGTGCTAATCA TGATAATAGTTATAATAA TATTAATAGTTTAA ATATACATTTGTATCTACATACATACA ATATTATATTATATAGTATGTTTGT # Name br-Z4 # Matrix A| 5 2 1 8 8 1 C| 0 5 0 0 0 0 G| 3 0 0 0 0 0 T| 0 1 7 0 0 7 # Construction Info Meme was run on the footprints with fixed width 6 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "8062827" "8582299" # Footprints AAATAATAAACAAAATAATAAACAAAACCACGA GTAAACTAAAGCTGGTGC ATACCTTTCTATTCTGTAAATATTTGTGAAAGACAAGTTCG GAATGGTTAGAGCTAATA TTATTAATAGAAGT TGCTAATCAGTG TGAATACTAATTACT GATGATAATAGTTATAA # Name byn # Matrix A| 8 4 0 0 0 1 3 7 C| 0 0 0 1 0 7 0 0 G| 0 2 8 0 9 0 4 0 T| 1 3 1 8 0 1 2 2 # Construction Info Meme was run on the footprints with fixed width 8 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "11850413" # Footprints CGGAAAGTGCTAATTTTTACACATA TGTTAGGTGCGATATCTCCA AAAGAAGTGCGACTTTTAACATCCA AAAATAGCGCCACTTCTCGAAATCGCACTTAG TGATTTTTTCACCTCG CAGTTGTAACACATAAAT AATTTATCGCGCAAGCAATTTGCACAATTT GGAGCGAACGACGCGATTTCTCCC CATGTGCATTCAGCAATGTG # Name cad # Matrix A| 0 2 0 1 6 0 3 7 0 C| 5 0 0 0 2 4 1 3 4 G| 3 3 0 0 1 3 9 2 0 T| 5 8 13 12 4 6 0 1 9 # Construction Info Meme was run on the footprints with fixed width equal to the width of the smallest footprint and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "9376314" "7617036" "2571934" # Footprints GATTATAAT GCTTTGCGACAATTAAG CGTACTAATTA ACACCCATCATTTTTCAATATTTGAGCG AACGAAATCGCTG ATTGGCCTAAAAA CCACGTTTGCACG GTCATAAAGTCA GTAACCATAAAAATT CGAGCCAAACAA AAGCGGAAAA AATTTTTAGGGAACCATAAACGG AGTTTTTATGTCTTTATGATT # Name Cf2-II # Matrix A| 1 1 0 0 3 0 3 2 C| 0 1 0 0 0 0 0 0 G| 2 0 3 0 0 0 0 0 T| 0 1 0 3 0 3 0 1 # Construction Info Meme was run on the footprints with fixed width 8 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "1411512" "2120114" # Footprints AAGTATAATATAA TAGTGTATATAGGTCACGT ATTTGCGTATAAAAGCGA # Name Deaf1 # Matrix A| 0 0 0 0 0 1 C| 3 0 10 0 0 3 G| 0 0 0 10 5 4 T| 7 10 0 0 5 2 # Construction Info Meme was run on the footprints with fixed width 6 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "11014815" "8617243" # Footprints AGCTCGTCGGA AAAACGAACGGCAGTTCGTTGCCTTCGTTCTTGCTTCGCGTGCTTCGTATCTTG ATTCGGCTGGC TCGTCGGCTACCTCTTCGGGTGGGGC CAGCGCTCGGTCCA CCACTCGTCAGTCAGTCG TTTTTCGTGGGGA CGTTTCGGAATTC CAACCGACTGGCGGCAAAAAGCGATCGATGGTTCGCTTTTAGCCCGAAGCTT AGCGATCGACTTCGACTCATTTAAGTGATTCGTGTAATTATTTTA # Name Dfd # Matrix A| 1 1 15 15 0 1 8 0 C| 2 0 1 1 0 0 0 5 G| 2 0 0 0 0 5 6 2 T| 11 15 0 0 16 10 2 9 # Construction Info Meme was run on the footprints with fixed width 8 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "11014815" "1995417" "7910795" # Footprints TTTAATTTG TTGGCGGCTATTAAG ACTACATTAATTAT CCGCGATAAGTAA CCTATCATTAGA ACAATTATC TGATGACTTAATTAC CAACATCATTAAGC TGGCAATTAG TTAAATGGTC GCTTCATTAT CGAAATTAAATCAATCAGAGATAATC GGTAATGGGT GTGTAATTATT TTTAATTGTT TTTAATGACT # Name dl # Matrix A| 2 8 3 33 34 36 24 4 8 8 C| 8 4 0 1 2 0 1 12 23 24 G| 22 26 34 4 0 1 2 3 2 4 T| 6 0 1 0 2 1 11 19 5 2 # Construction Info Meme was run on the footprints with fixed width 10 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "8458580" "1644293" "1648449" "1325394" "8344257" # Footprints GAAGAATAATTTCCATTT ATCTGGTTTATCTAGA ATACCTGAATTTTCCACCT ATTTATATTCCCACT CAATGCGTACTTTCCGCTACC CAGTCGGATTTTCCTGA TCACGCGGAAATTCCACGG TTGAAATTTTTCCTAAGA TAAATGGCTTTTATATT ATTTCGCATTATTTTCCG TTATAGGGTCGAACAATAAAG ACTCGGAACCCAAC CCTCCGGTTGATTCCCGCT TCCCCGATTTCCCTG CGATGGGAAACTTTCCCAAC AGCGCGGAATTCCAATT ATTTCGTATTTCCCTGC TAAAGTAATTTCCCATC CTGGGGGTTTTCTATAT TGGTGGGTCATCCCGGA TCGCGGGAAAATCCGCAC GGTCGGGTTGGCCCGCT GCCAGTGTTTTCCGCTT TTTGGGGAAAACCCTTT TGACTTTTCGCT GTATTTTTCTGGATTTTCGGA GCGATTTTCTCG GGCATTTTCCCA GAGAGAAAACCC AACAGAAAAATC TCGAGAAAATCG TGGGAAAAACAC GCGGAATTTCCT GGGGAAATTCCC TGGGAAAAGCCC TTGGTTTTCCC TGGGAGAAACCC CTGGATTTCCC # Name Dref # Matrix A| 3 2 4 0 8 0 0 0 6 2 5 4 C| 0 2 0 0 0 0 8 0 2 1 1 1 G| 1 2 0 0 0 0 0 8 0 0 1 3 T| 4 2 4 8 0 8 0 0 0 5 1 0 # Construction Info Meme was run on the footprints with fixed width 12 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "9819433" "9748283" "8093616" "8662923" # Footprints GCGATATTTATCGATAGTCTCG TATTCGATATTACGATA GGCGGGAACATATCGATAACAGAGCTACGAT TGCAATGTAATATCGATAGTGTCGTT GTGGTAATATATCGATAGGTGGCAGCG ATGGGCGATAACAATCAC ACAGATCACGGTTATCGCAGCTC CTATGCTTATCGATAAGAAAACT # Name dsx-F # Matrix A| 0 0 2 0 2 3 2 0 0 0 2 0 1 3 C| 3 0 0 3 0 0 0 0 0 1 0 1 1 0 G| 0 0 1 0 0 0 0 3 0 1 1 0 0 0 T| 0 3 0 0 1 0 1 0 3 1 0 2 1 0 # Construction Info Meme was run on the footprints with fixed width 14 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "1907913" # Footprints CACAACTACAATGTTGCAAT GGAGCCTACAAAGTGATTACAAATTAAAATA AGGTGCTGCTAAGTCATCA # Name dsx-M # Matrix A| 0 0 2 0 2 3 2 0 0 0 2 0 1 3 C| 3 0 0 3 0 0 0 0 0 1 0 1 1 0 G| 0 0 1 0 0 0 0 3 0 1 1 0 0 0 T| 0 3 0 0 1 0 1 0 3 1 0 2 1 0 # Construction Info Meme was run on the footprints with fixed width 14 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "1907913" # Footprints CACAACTACAATGTTGCAAT GGAGCCTACAAAGTGATTACAAATTAAAATA AGGTGCTGCTAAGTCATCA # Name Eip74EF # Matrix A| 6 2 0 0 0 0 0 0 2 2 C| 0 5 0 0 7 7 0 0 0 0 G| 1 0 0 0 1 0 2 5 2 1 T| 1 1 8 8 0 1 6 3 4 5 # Construction Info Meme was run on the footprints with fixed width 10 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "8557043" "2208281" # Footprints GAGATTTCCTTTTGGCTT AACAAGGAAGTGTTAT ATTCTTCCTTGATCGATG TCAAAACTTCTGGTATTTT GGTCCTAACTCAGGAAGC CAATTGCTGTTGTTCCTACTGTGT TGATTGATCAGGAATTATGGT ATGAGTTACTTCCGGTTATTCA # Name ems # Matrix A| 0 1 3 0 0 3 0 3 C| 0 0 0 0 0 0 2 0 G| 1 1 0 0 2 0 1 0 T| 2 1 0 3 1 0 0 0 # Construction Info Meme was run on the footprints with fixed width 8 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "9491376" # Footprints AAACGATAATGACA ACATTTTTATGACA CAAGGATTAGATAT # Name en # Matrix A| 20 5 7 38 52 0 0 27 C| 3 15 7 0 0 2 6 0 G| 18 12 0 4 0 2 14 26 T| 12 21 39 11 1 49 33 0 # Construction Info Meme was run on the footprints with fixed width 8 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "7600986" "8562421" "7713429" "2573829" "2895896" "3046753" "8404855" "8601485" "7600980" # Footprints CAGTAAAACAAAAAAGTAATGGTGTAAAATAATTATTATTATTATTAAATAATTATTATTATATTAAATAATTATTATTATATTATTAGGAAC ACTTACATATTAATATATTTATTAATTAATT CAGTGTGGTAATTATTTTCTTAATGCTACATTGTCACTTATTAAAGT CTGCAATAGATTGT CTGTGGTACGAATGACGTAACTCTACTAATGATTATACTATTATTCGGTGAAAAATATAATCTTGTTATCCCATTTCATAGATATAC AGTAATGCTTGTAAATACTACC TGAGCGGATTTAACGTTCTCCATTTTGATTTGCCTATA CAGAAGTATTGAAGAAAAATCCTAAGAAACTGTCATAATAACTGAACTAAATTACTGG AAGTGTTTACTAATCCTAAACAGAACAATAGACATTTAACTTAATACCTTTCGGTATGGAGAC ATTGAACTCCATGATTGTAAGCTATAAATTTTAAGTTATTAGCAATCGTTATTGGGACTTT TCGATACCCAAGAAGCAATTATT AAGTTGATTGAA GTCGCTGCTAATTGGCAGTACAAAATGC AGCTACTTAACTGCT GATGGATTGCTGATGA TCCGACTGACGGTGCAGAACCCAT AGCGCTAATT ATATAATTG GTTAATTAC ATTAATTGA CGATTAATTAT CAATTGCGCGC ATTTGCATTTCATTACAAATGACATTTGAGGGG ATAATAATCTATTTTA ATGATATCATTTGTTTC AACTCTCTAATTAG CGGCTAATTGG TAAATTATAATTTAATTGACC AAAGCTAATTGTTTTAATTTAAATGAA CTTCAATTAACCAGTTAAATGTG CGAAATTGATTGATATTTAATTGACATTTAATTTATT ACATCCAATTAATCAAC GTTAATTGCATAA GTGATTAGTCAAT ATCATTTGTTGATTAGTAAATCAAAGAAGCTCATTAATTTTCCTGAAAAGTAC TAGAGAATAAGAGTCATTGCAGGTCGG TTTCATTTGCCTAATTT TAAAATTAAATGCCTTTCAATGATAACTACTCAATAAATT CACTGTCTGATAGAAGTACCTCTTATCATCTGAA CATCCAGCAAAGTGGGCAATAGCATGCTAACAGGG GCCAAATTAGCAG TCACCATCGGC GGCCATTAAAAAAGG AAAAGATCGCTCATTAGCAG GCAAAAAATTATGATTGTTTC CAAAATCGATTTCAAGTTCAGCGATATG TCATAATAAATATTCGCGGGCCAGGCAATAAATAATAGTCCAAATAC ATGAATGAGTCAATGAATCACACAAATGAATTGTTTGGTTG GCTTGATAAAC ATTAATTAGACGT TGAAACGGGAA ATGCTCAATTACAT GCTTAATTAG # Name Espl # Matrix A| 0 0 0 0 1 0 1 0 0 0 0 0 C| 1 0 0 0 2 4 1 2 1 0 0 3 G| 0 3 0 4 1 0 1 1 3 0 4 1 T| 3 1 4 0 0 0 1 1 0 4 0 0 # Construction Info Meme was run on the footprints with fixed width 12 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "8078474" "9649507" # Footprints TGGCAGCCGGCACGCGACA ATGAGCGTGTGTTCATTTTATTTGTGCCCTGTGCTGCGCACG AGCACGTGTCAAATGCAGATGG GCCACGAGCCACAAGG # Name eve # Matrix A| 6 0 2 3 16 19 0 3 7 3 1 0 C| 8 3 5 0 0 0 5 4 0 0 0 6 G| 0 10 3 0 2 0 0 5 6 2 7 1 T| 5 6 9 16 1 0 14 7 6 14 11 12 # Construction Info Meme was run on the footprints with fixed width 12 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "1671662" "2895896" "1968224" "10885752" "2569362" "10644409" "9362473" # Footprints CCAAAATATTATGGTGTGCCCCGCT GCACAGTCAGCGCGAATTTGCTGCGGTGAGTCGATGCT GTCCCGCCTCGTTATCGCCGCTCAGCACCGAGAG CTCAGCACCGCACGATTAGCACCGTT AAAGCTAATTGTTTTAATTTAAATGAA CTTCAATTAACCAGTTAAATGTG CGAAATTGATTGATATTTAATTGACATTTAATTTATT AACATTAAAATTAATAAATTATTACAAAATGACAATACATTAACGC CAGCTTTAATCATTCCTC CTGAAATAAATTTACTTTAATGTT ACAAACCATTAACACCCGAA TGTCGCATGATTAGGGGCCATTACAAA GTTACGATTATTACTATGTTTATTGTTATTGCAATTATTATTATTATTTTTATGGTTTTAACGATTTGAACGATTATTAGCCATAGT GGGCCAATAATAACAATAATGCCGCTGATAATGTGGATAATAAAACAA AACGGTAACTGTTCAA GACAAAATAAAAAAG TACGTAATATTAT CAGTTGTAAATCATTGT CGTCCTTAATTGCCTGATGAGCCATGAAATGATGTCA # Name exd # Matrix A| 0 1 0 1 2 3 1 0 2 3 C| 0 0 0 2 0 0 1 2 0 1 G| 1 0 0 1 3 0 1 1 0 1 T| 5 5 6 2 1 3 3 3 4 1 # Construction Info Meme was run on the footprints with fixed width 10 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "7915199" "7859741" "9155029" # Footprints CATTTCGATTTC ATGTTTGTTTTA TATCAATTAG TAGTAATAAA TTTTATCGAT TTTGGAGCTAATGCGTGGCAAT # Name ey # Matrix A| 0 0 0 2 0 0 0 3 0 0 0 0 0 0 2 1 3 2 C| 2 2 3 1 3 0 3 0 2 0 1 0 0 2 0 1 0 1 G| 0 0 0 0 0 0 0 0 0 1 1 3 2 1 0 1 0 0 T| 1 1 0 0 0 3 0 0 1 2 1 0 1 0 1 0 0 0 # Construction Info Meme was run on the footprints with fixed width 18 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "11830564" # Footprints GTTCTCCACTCATTCGTGTGAAAGTTAGTT TATAGACCAACTCACTCACGTGGCAAACTCG TAAAAATTAATTCCCCCTCACTGGGCACAACT # Name ftz-f1 # Matrix A| 0 0 1 0 0 0 2 0 0 0 0 0 1 1 2 0 0 0 C| 0 3 0 0 1 0 0 3 3 0 0 2 0 0 1 2 0 0 G| 2 0 2 3 0 3 0 0 0 0 0 1 2 2 0 0 1 2 T| 1 0 0 0 2 0 1 0 0 3 3 0 0 0 0 1 2 1 # Construction Info Meme was run on the footprints with fixed width 18 and flanking sequence was added for footprints less than 9bp or the fixed width. # Pubmed Ids for Footprinted Sites "9043065" "8164672" # Footprints CGTGAGCGGTGACCTTCGACCTGA TTGTGGCAGTGTCCTTCGGATTTA ACCGTCTCAAGGTCGCCGAG # Name ftz # Matrix A| 19 16 7 39 56 6 11 54 C| 4 14 40 25 9 0 7 3 G| 31 22 6 0 0 0 2 3 T| 12 14 13 2 1 60 46 6 # Construction Info Meme was run on the footprints with fixed width 8 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "9431813" "9043065" "3046753" "10885752" "1976571" "1982071" "8404855" "8601485" "1356761" # Footprints GTGCATTAG TGTATTTTCATAATTTTCATATTTCTCCG CGCTAAAGTG TGCCAAATTAGC CTCTAATTAGC GGCTAATTGGC ATTTAATTGAC GATTAATTCCT CGACCATAAAA AAGCACTTAAC CGTCAATTAAC GTCACATAAAG GCCTAATTGTG GATTTATGACAC CCTTCAATTAACCAGTTAAATGT AAATTGATTGATATTTAATTGACATTTAATTTA TGCGGTGTGTC ACAAACCATTAACACCCGAA TGTCGCATGATTAGGGGCCATTACAAA GACAAAATGTCTTTTACA CGAAACATTACTGCCATTACAG GTCTCGCATTAGACTGATGTTCT TGTTTATGGATAGTAAATGCA TGGGTCCTTAAGCGTCTTAATTGCCCGCGTA CAGCGCAATTGGTTTCCAAGGCGGAAATATTATTGGCACATCATAAAACTATAAAAC CATTGTTAATGGACGTTATCCTTATTAGA GTTAGGTATTAAGATCTGA GCTTCATTATATTATAGATTA ATTGTTATAGTGCACGGA ACACAAGGTACAAGGT CACATGACATTAT CAAAAAGCCATCAA CTAGGGGCCATAAGCAG TACGGGGTCATCATTGCTAAAAG GCAGGACAATTCGAATAAGT TGACAGGAGCAATTACAG GCAGGCAATTCAAGGA TGACTTTGATTGGTGCC TATATCCACCCATTGAG TGAAGATTACTTCATTTA TGTTTACCTTAATTGCTTATA AAACATTTAATGGACA GCTAATAGTAACA TAATATACTTATGTCAA CGATTACAATTACGATTACGGTTACGATTACGGTTATTATTATAATAATGGGTTTA TGTGCGACTGATT CGGTTCTAATTTTTTACGATTATTGTTATGATTATTTTT ACGGCCTTTATGATCTTAGCGGGCTGACAATTGGGA CTATAAAATCAATTAA AATAATTGTACAATTTAC CTGCTTAAGTACTTATAA GATGTTCTTAATTAA CAAAGCAAATT CTATTTAATAATAA TCACATCAG TTGCATAATTATTTAATAATGTGAAATTAACATAATGTATTTTTGTATAATAGTTACCATTACTC ACGCCCGGCACTTAACATTGTACTTTTTATGACCTCGTAAAAAAACTGCAC CGACCTTGAAGGCGGCGTCAAAAAGTTAATGATCACCATCGGCTCT ATGTTTCTCATGTG CCGCACACATA GCCGTCGGCCATTAAAAAAG CGGTAAAAGATCGCTCATTAGCAGCAGCT TTTATTAGCCATGG ATTATGATTGTTTCA TATATTACCTTGA TCATTTAATTTGTTTAGA # Name gl # Matrix A| 5 0 0 0 1 4 3 0 1 3 0 2 C| 0 0 0 0 2 1 0 0 1 0 0 1 G| 0 1 0 1 2 0 0 4 2 2 0 0 T| 0 4 5 4 0 0 2 1 1 0 5 2 # Construction Info Meme was run on the footprints with fixed width 12 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "2010085" # Footprints GCGAGGCTTCTAAAATCAATGAAATACTTTTCGGGCTGCACCGATGGGGCTTCTC TTATGCTGCCACTCAAG GTTAAAGGCATTTCAAGGGTTTCCA AGCGATTTAATGTGTCA AATTTGAAGAATATTATGAAAACATATCGTAGCAGAAGAAATATCAGTATCG # Name grh # Matrix A| 2 0 0 1 0 0 0 2 3 1 C| 6 1 0 0 1 0 3 1 2 3 G| 0 0 6 6 0 0 1 1 3 0 T| 0 7 2 1 7 8 4 4 0 4 # Construction Info Meme was run on the footprints with fixed width 10 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "8543160" "2792757" "2606344" "8543159" # Footprints AGGACCGGTTCAAT AGGGGCAACAAGTTGCCTGGC ATGATTCGGTATCGAAA GGGGAGCTGTTTTTCC ATCGGATGGTTTTATATCCTACTCTACACCCTTATT ACTGCAAAACCAGAAAG CGCTCAAAACCAGATTG TGCGTTCCTTGCTCAATGAATTTT # Name gsb-n # Matrix A| 0 2 2 0 0 0 1 0 0 1 2 2 C| 0 0 0 0 0 0 0 1 0 0 0 0 G| 0 0 0 0 0 0 1 0 0 0 0 0 T| 2 0 0 2 2 2 0 1 2 1 0 0 # Construction Info Meme was run on the footprints with fixed width 12 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "7906390" # Footprints GTTATAATTTATTTAATGGC TGAGTAATTTGCTAAACAT # Name gsb # Matrix A| 0 2 2 0 0 0 1 0 0 1 2 2 C| 0 0 0 0 0 0 0 1 0 0 0 0 G| 0 0 0 0 0 0 1 0 0 0 0 0 T| 2 0 0 2 2 2 0 1 2 1 0 0 # Construction Info Meme was run on the footprints with fixed width 12 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "7906390" # Footprints GTTATAATTTATTTAATGGC TGAGTAATTTGCTAAACAT # Name gt # Matrix A| 3 0 5 0 0 6 0 0 0 5 5 2 C| 0 0 0 0 0 2 5 0 3 0 1 0 G| 0 1 2 0 5 0 2 4 0 0 0 1 T| 5 7 1 8 3 0 1 4 5 3 2 5 # Construction Info Meme was run on the footprints with fixed width 12 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "2026328" "1576969" "7617036" "10644409" # Footprints GCGAGATTATTAGTCAATTGCAGTTGC AGACTTTATTGCAGCATCTTGAACAATCGTCGCAGTTTGGTAACAC AGAAAGTCATAAAAACACATAATA GATTCTTGCGTCATAAA TAATTTTACGTAACATT AAAAAACGCACAA AAAAAGTCAAAAAGCA TTTACGTAATATTATGAAAGGTGC # Name hb # Matrix A| 17 0 1 0 0 1 59 20 C| 13 0 5 1 0 4 7 17 G| 7 3 1 0 0 0 29 14 T| 66 100 96 102 103 98 8 52 # Construction Info Meme was run on the footprints with fixed width 8 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "9376314" "2507923" "1671661" "2065664" "8186146" "9250684" "9507113" "7617036" "1546296" "2797150" "8404855" "1902784" "12853632" "1687458" "10644409" # Footprints CAAGCCGTTTTTCAGG GTTTTTTGTTT GATTTTTGTGC TCTCTTTACGG CTTCTTTGTTC ATTTTTATGG GTTTTTTGTTC CTTTTTTCGC GTTTTTTTCCC ATTTTTTAATTC GTTTTTAAGA CGTTTTTACGA TCATAAAAACA GTTATTTTTTT ACGATTTTTTT GCCTTGAAAAA TTTATTTATTTG CATGATCATAAAAAGCAATTTGCTACAATTTATATTTTTTTGCTTTTCCTTCTTT ATCAGAAAAGAAAAAGTGTAA AATTTTTTCAGACA ACGCGTTTTTTCGC CATTGTTTTTTTTTTCAGTT TTCTCTTAAAAACAACAAAAAATGTCAAAGTAAAAACAATGCAAAAAAT GGAAGAAAAAAA GATTTTTGCGT AACATAAAAAGG ATGTTTTTATGA AATTTTTTTTCC CCATTTTTAGCG GTGACAAAAAAGATGAACAAACAAAAAAG AGATTTTTAGTG CATTTTTTGTTCTAATTATTTTTTATGA ACTTCTTTGTGG GATTTTTTATTT GTTCTTTTTGGC TCTTTTTTGTG CAATTTTTAGC CAATTTTTGTGG TCTTTTTTATT TTTTTTTTTTG TCCCAAAAAGT GCAGAAAAAAC GCACAAAAAAC CAATAAAAAAG TCGCAGTTTTTTACGATC CCGTCCGTTTTTTAAGCCTT AATAAAGTTTTTGACCAGATT TAGCGATTTTTTAAAATGTTTTTTTTTTTTTGTTTTTTTTAGA TTAAAAAACA GATAAAGAAGA AATGCGATTTTTTATG AGACAAAAAAGGGTTT ACCCTTTTAAAAGTC CACTTAACTCTTTTTATGAATATTTAT CCAAAAAGAAAGAAGGAGCTACCTG GGGAAAAAA TTGTAAAAAA CATAAAAAA ACAAAAAAC AAGTTTTTTGC ATAATAAAAAAA ATTGGCCTAAAAAACTC CAATTTTTTAAGCG CAGAAACAAAAAATTAT AAAACGCAAAACGGGAA TATAATTAAACAACTAT TGCCGTTTTTTGGCATC AATTGTTTTTTGGGCAA TCCACCTTTTTAAGCTA ACCAATTTTTTTCCCAA TGGACTAAAAAAAAAAA GCCCATAAAAAACTGCCAA TTGTACTTTTTATGACCTCGTAAAAAAACTGCAC TGGAACGATTTTTTAATGTTTCTC GCACACATAAAAAACGGTTCCCTAAA CACGCTCTTTTTACGCTGC ACAAAAATACGAGTTAG AAATTTTCACTGGGCAATTAAA CTCTCTTTTTGAGTTATCG ATTTCGCACTGGGGTTTTATGGCTCATTTTC TAAAAGGGCCGTAAAAAATATTTTTATTT GCTTTAAGTGATTTTTAGTGGCCTT TGCACTCATAAAAAAACTTGGTC CGTTTTAAATATTAATTTAGGGA AAACAAGTTTTTGTTGAAAAAGA ATTTTTATCTTGGGTTGCAT CCTGATATTTTTAAAAGTCA AGTTCTTTTTTTATCTTAATCTTTTTTCATCTTTATATTTTTTTTTAAAA ACCTGCAAGTTTTTTAAGAAATTTTC TCGGCATATTGAAAAACACCATAAAT ACAAAAATAGTTTATTTATTTCGT AGACAAACATAATTCTTTTT CTGTTGGTAAAAAACC GCGCCATAAAAAATGTG CCGCTTAAAAATTC GGCCATTAAAAAAGGTGCC GACGCAGTTTTTTATTAGCCATGGCAAAAAATTAT TAAATCATTTTTAAGGG TGTTTCTTATTTTT ATTTTTTGCG ACGGCAATTTTTTATGGTT AGACAAAATAAAAAAGGGA TCCGCTGCATTTTTTATGAG # Name His2B # Matrix A| 5 0 0 0 1 0 1 0 3 0 0 4 0 0 0 3 4 0 C| 0 0 5 2 3 1 2 0 2 0 1 0 1 1 0 0 1 4 G| 0 1 0 2 1 3 2 5 0 0 0 0 4 4 0 0 0 1 T| 0 4 0 1 0 1 0 0 0 5 4 1 0 0 5 2 0 0 # Construction Info Meme was run on the footprints with fixed width 18 and flanking sequence was added for footprints less than 9bp or the fixed width. # Pubmed Ids for Footprinted Sites "1480489" # Footprints AGGATAATCTGCAGCTTAGGTAAGCTGA AGCTTAGGTAAGCTGATCCCGCGATTA AAGCTGATCCCGCGATTAGGTAACGAAAT CGCGATTAGGTAACGAAATCGCTGGCT TAACGAAATCGCTGGCTTAGGTACCCAC # Name hkb # Matrix A| 0 0 0 1 0 0 0 0 0 0 0 0 1 0 C| 0 1 2 0 0 0 0 0 2 0 0 0 0 2 G| 0 0 0 1 1 2 2 2 0 2 0 0 1 0 T| 2 1 0 0 1 0 0 0 0 0 2 2 0 0 # Construction Info Meme was run on the footprints with fixed width 14 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "9376314" # Footprints TCCGTGGGCGTTGCAT TTTCAGGGGCGTTACC # Name HLHm5 # Matrix A| 0 0 3 0 0 1 0 1 0 3 C| 1 3 0 3 0 1 0 1 3 0 G| 2 0 0 0 3 0 3 0 0 0 T| 0 0 0 0 0 1 0 1 0 0 # Construction Info Meme was run on the footprints with fixed width 10 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "8078474" # Footprints TGGCAGCCGGCACGCGACA AGCACGTGTCAAATGCAGATGG GCCACGAGCCACAAGG # Name Hr46 # Matrix A| 3 2 0 0 0 0 0 0 0 2 C| 0 0 0 0 0 0 0 0 2 0 G| 0 0 1 0 3 3 3 0 0 0 T| 0 1 2 3 0 0 0 3 1 1 # Construction Info Meme was run on the footprints with fixed width 10 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "9165123" # Footprints TGAAAGTGGGTCACGAATT GCAATTGGGTTTGACTTCAATTTTG CGATATTTGGGTCACTCACA # Name Hsf # Matrix A| 0 0 0 3 0 4 4 1 2 0 0 0 0 3 C| 0 5 0 2 0 0 0 1 1 0 0 5 0 2 G| 0 0 2 0 5 0 0 2 0 0 0 0 3 0 T| 5 0 3 0 0 1 1 1 2 5 5 0 2 0 # Construction Info Meme was run on the footprints with fixed width 14 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "3685975" "4028160" # Footprints TCCCTGGCATCCAGAAGCCTCTAGAAGTTTCTAGAGACTTCCA AAAATAAAGCGAATATTCTAGAATCCC AAAACTCGAGAAATTTCTCTGGCCGT GCACTGTTCTCGTTGCTTCGAGAGAGCG GCGCCTCGAATGTTCGCGAAAAGAGCGC # Name kni # Matrix A| 1 11 3 0 0 7 8 6 0 1 C| 1 1 3 19 5 11 4 2 1 5 G| 18 2 5 0 6 1 4 2 1 1 T| 0 6 9 1 9 1 4 10 18 13 # Construction Info Meme was run on the footprints with fixed width 10 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "8626035" "1348871" "8186146" "9250684" "7607084" "1687458" # Footprints TAGAAAACTAGATCA GCCCGGTGCTCTCTTT ATGGCCGCGTTCCCAT TAGGAAAGTAGATC GCTGCGCTAGTT AACTGAACTAAATCCGG TGACCGAAATA TGATCTCAATGTTCTGATCTCGTTC AGAGCGACCTG TGCTCGACATGTTCCCATTTTTTGTTCTAATTA AAGTAGAGCGC GGATCGCAGTTTTTTACGATC GTTTTACGACCTCCGTCCGTTTTT TGCTCTGCCATCCTCTGACCCGTTCAGTTCAAATCAGTTCGGTGTC CAAAGACGATC GGACCCATTT GAACTGGAAC ATTATGATTGTTTCATATTT GTTCCCAATT AAGCTCATTT # Name Kr # Matrix A| 37 33 20 2 4 6 1 8 28 16 C| 0 6 11 0 1 3 3 4 6 8 G| 4 1 9 40 37 35 4 4 5 5 T| 3 4 4 2 2 0 36 28 5 15 # Construction Info Meme was run on the footprints with fixed width 10 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "9376314" "2507923" "1683715" "1671661" "9250684" "7607084" "9507113" "7617036" "9311990" "2797150" "1687458" "10644409" # Footprints ATCGAAGGGATTAT GCAGCCATTACCCTTTTGTTGGCCAAAGGATTTGT TGAAATTTGTGCCATCCTTTT GTTAAGCAAAGGAGTGTCATAGAAATGGGTGAAATTCT TATAACCCAAT GTTACCCGGT GTAACTGGGACA GTTAATCCGTT GTAACACGCT TAGACGGAAT GAGGGACCCTG GACCGGGTTGC CTGGGATTAGCCAAGGGCTTGA ATCCAATCCCGATCCCTAGCCCGATCCCAATCCCAATCCCAATCCCT CGAAGGGATTAG AACTGGGTTAT CTTAACCCGTTT ATTAACCAGTT TGTCACTCCTT TTTAACTCAGC CTTTCCCTGCC CGAAACCCTTT CAAAGGGTTCG CAACGGGTTTT TTTAAGCCTTT TCTGACCCGTT TTTCGGGTTCT AAAAGGCTTAA CTTGGTGTTAA AAAAGGGTTTT CGTAAAAACTCTTTGCGAATC CTAATCCGTGGAAACTCTAAACTCTATCCCAGAGAGAACCTCTTTCGGCGCGAG TGTAACCCTTTTAAAAGTC ACTTAACTCTTTTTATGAATATTTA CCTGTTTAACCCTTTTATGCC TGCTTAACCCTTTTATGGGC CATTGTACCAAAAGGGTTGTTC TAAAAGGGGACTGT GTCTACCCTTTT GAAAAAGGGTAAT TTGCGGGACTTAA AAAGGGGCATTTA AAAAGGGTCAC CAGTGCGTGAAAGGGTGAAGCTAC # Name Mad # Matrix A| 1 1 3 3 0 0 6 0 5 1 C| 12 5 0 8 16 0 2 15 0 15 G| 5 7 16 8 1 20 6 4 15 0 T| 2 7 1 1 3 0 6 1 0 4 # Construction Info Meme was run on the footprints with fixed width 10 and flanking sequence was added for footprints less than 9bp or the fixed width. # Pubmed Ids for Footprinted Sites "9230443" "11159914" "9694800" # Footprints CGTGCCGGCCA CGAATCGCGACGGCAGCCA GCGACGGCAGCCA TAGGTAGACGACAT TCCGCCGACGCATC TGGACTGCCCGACTGGCACCTCGGAGACT TCTGGCGTTGCGTGAGAGACA AGTCTCGCCAGGTAGACGGGC CGGTGGCGGCGCTG AGCTGTTGTCGCGGCT GCTCGCCGTCCGC CCGACGCGGCGAATGCGAATCTGTCTCGGG GCCTGGCGGCGCCC CTGACCAGCCACGCCCCGTCGCGAAGGCGG ATTACTGTCTCGTCTTTCAATGTCGGCGGCA TGTTGCGGCGACGTTTGC CGGTCTGGAGTCTAGACCGGCGC GTTCGCCCTGGAGCGCCGT AGCCGCTGTCGCAGCTG AGCCTCCCACC # Name Med # Matrix A| 0 0 0 1 0 2 0 0 1 3 3 0 C| 1 7 0 2 8 0 0 1 4 2 1 1 G| 5 0 8 3 0 3 5 4 3 1 3 1 T| 2 1 0 2 0 3 3 3 0 2 1 6 # Construction Info Meme was run on the footprints with fixed width 12 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "11783990" "9694800" # Footprints ATCGTCTTGGGAT AGATGCAGCCGCAG CCAAGTGGCGGGCAGC GTTTTTTGTCTGACTGACTGACTGCCGGTG AAGCCATGGCGCCT CTGACCAGCCACGCCCCGTCGCGAAGGCGG ATTACTGTCTCGTCTTTCAATGTCGGCGGCA CGGTCTGGAGTCTAGACCGGCGC # Name nub # Matrix A| 1 0 3 0 1 0 4 2 0 0 C| 0 0 0 0 1 3 0 0 0 2 G| 0 0 0 0 2 0 0 1 4 1 T| 3 4 1 4 0 1 0 1 0 1 # Construction Info Meme was run on the footprints with fixed width 10 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "9665883" # Footprints ATTATACAAGGCCGC TTTATGTAAGTAACC CTTTTGCATGCCCAT CCCGCCTGGATATTGCGGC # Name ovo # Matrix A| 0 3 0 0 0 11 2 5 C| 12 6 0 1 0 0 7 2 G| 0 0 12 0 0 1 1 0 T| 0 3 0 11 12 0 2 5 # Construction Info Meme was run on the footprints with fixed width 8 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "9634487" "10637336" "11290304" # Footprints TAACAACTTACAGTAACAGT AGAAAAATAAAGCCGTTAAAATTGAATTTA CATTTTAAATGTAACTGTTAATAT CACGACTACAGTTAGAATTAGAATGA TCCTTTTTACAGTTACATAGCAAT TGATTTTCCGTTGCTTTTTT TGTTTTCCTGTTACTTCTCTT GAGAAGTTCCGTTAATCGTACC CGCACCTAGCACCGTTACACGAAGAA TTAAAAAACTCCTGTTATCGCCGTCT ATGACACCGATAGCGGCATCATCTGT CCAGGAACCGTTACTTCTGC # Name p120 # Matrix A| 0 1 2 0 0 1 2 3 0 1 0 1 C| 2 0 0 0 0 0 0 0 0 0 0 0 G| 0 0 0 0 0 2 0 0 0 2 0 0 T| 1 2 1 3 3 0 1 0 3 0 3 2 # Construction Info Meme was run on the footprints with fixed width 12 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "12490953" # Footprints AATAATTTATTATTCATTATTAAATGTTT AGCGCCAATTGAATGTTA TGCTTTTGTATATAAATTCTACCAACGCAGCAGA # Name pan # Matrix A| 4 2 2 2 0 17 8 7 C| 10 3 0 0 2 0 0 11 G| 3 0 1 0 20 5 0 3 T| 8 20 22 23 3 3 17 4 # Construction Info Meme was run on the footprints with fixed width 8 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "11076769" "11783990" "14701680" # Footprints GATATATAATTTTCAAAGGTCTTACGA TTATAATTGTCTTCATCTTTT CAATTAGTTTTGTCGCGGTTGTCA GTTGTTGCTGCTTTGATTGTTTTGTC TTGTCTAAGATATCAAACGCACAGTGC TCAATTGTTCTAACAAAACATGCC AACACTATGGACACAAAAA AAAGTCCGGACTTCAAAGTCCATTTCG ACTTCGTTTGATCCCAAAGGAT TGCCATCAATTAGCA GATCAAAGCGAC TCACTTCACAGT AGGCACTTAAGATAT GCGATCCTTTGGATGCC GAGTTGTCCTTTAAT GCTGATCTAAATAC GAAATATTTTTTGATCTTGA CATTTCGTTTTGTTCGA CGAGTTTACCGCTGACGAAATTT CCTTGATCATCCGCTGAGCTTAGTTT CGGCTCTTTTTGGTATTTT CATTCAATTAG TATTTCAAATGCGATCGCCG TGATGGAAAAAAGAGTCCGCAAG CTTATATCAAAAGATG # Name pho # Matrix A| 2 0 1 1 0 1 4 0 0 0 0 0 1 2 C| 0 3 2 0 0 1 0 0 0 0 5 1 1 3 G| 3 2 1 3 1 0 1 0 5 5 0 1 1 0 T| 0 0 1 1 4 3 0 5 0 0 0 3 2 0 # Construction Info Meme was run on the footprints with fixed width 14 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "12853632" # Footprints CAGCAAACGATTATGAGGCCATCTCAGTCGCACTTAAAACGGCCATTACGAACGACAGTTATGGCGACGGAGCTGCAGAGGCAGCGACTGCGCCGCGACTGCGGAGAGAGGGAGAGATACGGTTAGCCTTCTCGCTCGGAT ACGGCGCAGCCATTATGGTGCGCG TGCCGTTATGGCTTCCGT AGGGGGCGTGGCCTAGAGAG TGGGGTTTTATGGCTCA # Name prd # Matrix A| 2 5 9 0 1 8 2 2 C| 9 5 0 0 0 1 7 4 G| 0 1 2 0 2 0 0 4 T| 0 0 0 11 8 2 2 1 # Construction Info Meme was run on the footprints with fixed width 8 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "1672661" "7906390" "10885752" # Footprints TCCTGCTCCTCCGCTTTGTCCCGCCTCGTTATCG GCACCGCACGATTAGCACCGTTCCGCTC GTTATAATTTATTTAATGGC TGAGTAATTTGCTAAACAT TCAATTTCCGGCGAAAATCGCATGAAGTC AGATAACTAAATTACCGCAA CATAATTGCGGTGT ACAAACCATTAACACCCGAA TTCCACTTTTTGTCGCATGATTAGGGGCCATTACAAA TGGTCGCTGCGACACGG CCAATGATCGATTTGACACGCCAACG # Name sd # Matrix A| 3 8 4 14 1 3 0 3 4 5 5 4 C| 0 1 8 0 1 0 8 5 1 6 1 3 G| 8 1 1 0 0 1 0 3 2 3 7 4 T| 3 4 1 0 12 10 6 3 7 0 1 3 # Construction Info Meme was run on the footprints with fixed width 12 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "11303087" "9869643" "12466192" # Footprints ATTTGTGAATGAAGT ATAACATTTAATT AGATAAACAGCAGTGT GGCTGTTTTTTTAAATGAATTTTCTCTA TAAAATTATTGAAATTAC CAATGTAATTCGAAAAATGTCGTC AATGGACATTCGTGGGATTCCAGAA AATGGACATTCGTGGGATTCCAGAA AGGAAATATCTT ATGGGAATTCCACGG GCACGCGGCATGGCA AGTTTGGAATGTT CTAAGAAATTCCTGGCATAGTTTAAGT TTACATTTGTCGCATAGTT # Name shn # Matrix A| 1 0 0 0 0 0 0 2 0 0 0 2 1 0 C| 0 0 0 0 0 0 1 0 1 2 2 0 1 0 G| 0 2 2 2 1 2 1 0 1 0 0 0 0 0 T| 1 0 0 0 1 0 0 0 0 0 0 0 0 2 # Construction Info Meme was run on the footprints with fixed width 14 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "11071761" # Footprints ATGGGTGCACCCAATC TGGAAAGCAGGAAAATCAGGGGGGAGCCACT # Name slbo # Matrix A| 9 0 0 3 2 7 6 11 C| 1 1 0 2 10 2 5 1 G| 1 0 3 7 0 2 1 0 T| 1 11 9 0 0 1 0 0 # Construction Info Meme was run on the footprints with fixed width 8 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "7720712" "1547943" "1459454" "7671793" # Footprints TACAATGTTGCAATCAGCGG AAGTGATTACAAATTAAAATA TCATCAGTGGGG GCAGTGATGCAACAGATTTTATA TTGTTTGCGCACAT TCCTTCCACAAAC GTTTTTTGCAATC AGCTCATTACGAAGGCAGGG TGCCGTGTTGGCAATAAAATATTAAACAATAATAA AAAATGACACAGATC GGAGATTTGGCAATATTTATTGATCCACTTA AAAAGAATAGTGGCACAATAG # Name sna # Matrix A| 0 4 10 1 1 0 0 1 0 3 C| 7 5 1 10 5 0 0 6 2 2 G| 3 1 0 0 0 0 10 0 2 3 T| 1 1 0 0 5 11 1 4 7 3 # Construction Info Meme was run on the footprints with fixed width 10 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "1325394" "1533042" "9840810" # Footprints GCAACTTGCGG ACACCTTGCTG AAGCGCAAGTGG AGCACATGTTT CAGCTTCCCACCTGATAGGACA TTGGAAATTCCC GCTCATCCTACCTGTTTCCAT GTCGGCAAAAGTCAACCTGTTGAATGCAGGAGT CAATGGCAGGTTGTTTTCTCAGGATCAGGTAACAGATCCTT CAGTTGCAAACAGGTGATTGCAGG GAGCAAGTGCTGAGAAGGTG # Name srp # Matrix A| 0 0 3 1 0 0 1 0 2 0 3 0 C| 2 0 1 0 3 0 1 1 0 0 1 1 G| 1 0 0 0 1 4 2 0 0 4 0 1 T| 1 4 0 3 0 0 0 3 2 0 0 2 # Construction Info Meme was run on the footprints with fixed width 12 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "8524261" "8187633" "10409761" # Footprints CGCTATCGATAGC GTAACGGTAGATAAT AGGCCTATCGCTTGACTCCCGATTGGG TATGTTTATCAGCCCAGAA # Name SuH # Matrix A| 1 2 0 0 0 0 0 0 3 1 1 1 0 0 C| 0 0 0 0 0 2 1 3 0 2 1 0 0 2 G| 0 1 3 0 0 0 0 0 0 0 1 0 0 1 T| 2 0 0 3 3 1 2 0 0 0 0 2 3 0 # Construction Info Meme was run on the footprints with fixed width 14 and flanking sequence was added for footprints less than 9bp or the fixed width. # Pubmed Ids for Footprinted Sites "8700202" "14701680" # Footprints CAGAAAAGTTCTCACGATCGC TTGTAGTTCCCAACTTGC TTGGTTTTCACATTCAAT # Name suHw # Matrix A| 2 2 1 0 6 0 0 0 6 5 0 1 2 4 2 3 0 0 C| 0 0 0 0 0 0 0 6 0 0 3 0 1 0 0 0 0 0 G| 4 4 5 0 0 0 6 0 0 1 0 5 0 0 0 0 0 1 T| 0 0 0 6 0 6 0 0 0 0 3 0 3 2 4 3 6 5 # Construction Info Meme was run on the footprints with fixed width 18 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "2850261" # Footprints GCAATATAATAATCTTTTATTGGGTATGCAACGAAAATTTGTTTCGTCAACGTATG GCAATATTTTTTATTAAAAGAGGGTATGCAATGTATTTTATTAAAAACGGGTATGC CAATATAATAATCTTTTATTGGGTATGCAACGAAAATTTGTTTCGTCAAAGTATG GCAATATTTTTTATTAAAAGAGGGTATGCAATGTATTTTATTAAAAACGGGTATGCAATA AAAAAATTATTTGGTTTCTCTAAAAAGTATGCAGCACTTATTTTTTGATAAGGTATG GCAACAAAATTTTACTTTGCCGAAAATATGCAATGTTTTTGCGAATAAATT # Name tin # Matrix A| 0 0 0 0 11 11 0 0 0 1 2 2 C| 2 8 1 8 0 0 0 0 0 4 5 3 G| 3 2 0 1 0 0 11 1 11 6 3 3 T| 6 1 10 2 0 0 0 10 0 0 1 3 # Construction Info Meme was run on the footprints with fixed width 12 and flanking sequence was added for footprints less than 9bp or the fixed width. # Pubmed Ids for Footprinted Sites "9034334" "11783990" "10588882" "10628847" "9694800" # Footprints GGTCTCAAGTGGGC AAGCCACTTGAGCC GCTTCACTTCACAGTT TCAGGCACTTAAGATA GTGGGCCCTTGAGAAG ATGCCCACTTGAGGAG CTGAAGCACTTGAGGAG TCCTCCCCACTTAGGCC GTCAAGTTCAAGTGCCAAA CATGTCAAGTGGCAC GCTCTCAAGTGGAGA # Name tll # Matrix A| 25 26 27 8 0 1 28 C| 2 3 0 1 1 20 2 G| 6 7 8 27 0 1 7 T| 4 1 2 1 36 15 0 # Construction Info Meme was run on the footprints with fixed width equal to the width of the smallest footprint and flanking sequence was added for footprints less than 9bp or the fixed width. # Pubmed Ids for Footprinted Sites "1348871" "9250684" "9507113" "1546296" "7555732" "11731230" "8404855" "8601485" # Footprints ACTGCTTTAACTTAATC GATTAAATTTT AAATAATCC CGTAATATTGA TGTTAATCTCCGG GGCAATTAAGAAGTCAAATT GGATTCTTGC AAACCAGTCAATCT TTCTATCAAGATTAAA ACTCCTTCTACTTTAA TGCCACAATTAAAA TCTGAGTCAGTTCT GTTCGGTGTCAACTCTTTC TAAGTCGAAAAGCCAAAAAGTCAAATGCGA TTTTAAAAGTCAACTTCC GCCTTATGGCGGCACTTAACTCTTTTT GCTCAAAGCCAAAAAGA TTTTATGCCGCTAACCGA ACCTTGACTTTTTCACTC AGCTGACTTCCCAGA AGATTTTCCATTTGACTTTCAT GTCGACACGCCACGAGATTTTATGAAGGCAACTCG TATCTATGAGTCTAATGGTC TGTGCGCGACCTCAACCCTTTC CACCTAATGTCGGCGTCATTGTCTTCTTT CTTTGGCGGACGAGAAAGTTG GCCGCGATCTT TCTTGGAATTAGTT AGCCATATATAACTTTAT TAAAAACCTGAAAGTGACATG TAACTTTTGCCTCT CTCTTCTGACTTTTGT TTTATGACCTCGTAAAAAAACTGCAC GGCGGCGTCAAAAAGTTAATGATCACCA ATGCATAAGTCAAGGATAA GCACCAAGGTCAAAA CTGACGACCTGACCTTGGA # Name Top2 # Matrix A| 0 4 1 4 0 4 0 3 1 4 0 1 0 4 C| 0 0 3 0 0 0 4 0 0 0 0 0 0 0 G| 0 0 0 0 0 0 0 0 0 0 1 3 0 0 T| 4 0 0 0 4 0 0 1 3 0 3 0 4 0 # Construction Info Meme was run on the footprints with fixed width 14 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "2557338" # Footprints ATAAAGTTAAATACTAAGATAT ATATTGAACTACATACATATACATACATACATATGTATGTACTTGTACATTT ATGTATATGTATATATGTACATACATATGTACATA CAACATATGTACATACATACATACATATGTA # Name toy # Matrix A| 0 1 2 1 0 0 5 0 0 0 3 0 C| 5 4 2 4 0 5 0 3 1 3 0 1 G| 0 0 1 0 0 0 0 0 1 2 2 1 T| 0 0 0 0 5 0 0 2 3 0 0 3 # Construction Info Meme was run on the footprints with fixed width 12 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "11830564" # Footprints GTTCTCCACTCATTCGTGTGAAAGTTAGTT TATAGACCAACTCACTCACGTGGCAAACTCG CGATTCACCCCTCACCGATTCCG TAATCCGATCATGCATTATTACCA TAAAAATTAATTCCCCCTCACTGGGCACAACT # Name Trl # Matrix A| 4 6 12 0 3 1 13 5 7 9 C| 22 23 6 64 0 70 0 54 13 33 G| 9 11 30 3 14 0 2 7 11 10 T| 36 31 23 4 54 0 56 5 40 19 # Construction Info Meme was run on the footprints with fixed width 10 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "7791801" "1408750" "2781290" "1985916" "8474442" "12200449" "2501151" "7984422" "2897243" "12853632" "8543159" # Footprints ACGTTTTCACTTATTTGTTTCTCAGTGCACTTTC AGTCATGCATTATTGTCTCAGTGCAGTTGTC CCCGAGAGAGTACG TTTCTCTCTCTCTCTCTCTCTCTCTTTC GCGTGTGAGCGGGAGA TGAGTGAGAATCT CCGAGACAGAGCGT AACCGCGAGTAATAT CAACTACCTCATTTTGC AAATCTCTCTACC TAGAGAGAGAGAAGAGAAGAGAGAGA ACAGAGAGAAAAAA ATGAGTGAGAGAGCCGAAG TTCTAGAAAGAGCGCAAAAGAAA CGCTGCTATTTGTCTCCAAC ACTCCCTTTGCTCTTCCTCTT GAAAAAGAGTACAGA TAGCTCTCTCTCTCTCTCTCTCT GTCTCACTCTCCCGCTCTCGCA CAGAGCGCGCGAGAGCGAG TAGCGCGCCACATTTAA GCGCACAAACTCAGA CATGAGACACGCA GTCACTCAGTT CCGCTCACGGAGCGCA ATCTTCTCACCGGAGCGCAA GCCTTCTCTTTCTCTT AACTCGAACTGAGACTGAGTAAA GATCGAATTTCGCTGCTCC GTTCTCTACTCGGGGAG ATCTATGAGAGAAGTG GCAACGCTCTTTGA TTGTCGAGCGGCAT AGATGGAGCGCAG ATGGAGAGGAGAGCAAGACGGC ACTCCACTCTGAAT GGTATCGAGC GAGACCCGCTCACGCACAC GCAGAGAAACGC GTTCACGCTCTGAACTTCA CGTAGAGAGCGCAAGCG CTAAGAGAGCGGAATGC CAGGGAGAGCCAAAGAGAGTAGGGAGC AACTAGTCCTGCAAAATA TTTAGAGAGACCAA ATTACCTCTCCCACTTC AATTAAAGAGAAAATGGCGAGAGAGTAAA AAAGTAGAGCAAA CTCTCTCACTCGCAC CCGTTATTCTCTATTCGTTTT CTCTCCCTCTTTGTACTATTGCTCTCTCACTCTG TGCTTCGAGAGAGCGCGCC AAAAGAGCGCCG GCTCTGCCGACTCAACTCACTC CAGAAACAGAGAGCCAG CGCTCTTGCGCTCTCTCTT GGCGCCTCTCGTTCAT GTGCGGTATGGAGAGATGCGC CGCTGCTCTCTCGCTCTAGCA AATACGAGTTAGAGAGAGTCCC AGCGAGAGCTTT CAACCAGCGAGAGAAGAAAGAGCAAGGC AAGAGAGCACCAAACAATTGAGACAAACCATTCA CCGCGACTGCGGAGAGAGGGAGAGATACGGTTAGCCTTCTCGCTC GATCGCTCTCGCTT TTATCTGTATCTCGCTCTTACGCAC TGGAATAGCCCTCTCTCTTTTTGA TGGCCTAGAGAGCAGTAG GTTCTTAACTTTGGATGCACTCATAAAA TTTTCGAGTTACTCTTATGAGATAATTCACGATAA CGTTCCTTGCTCAA # Name ttk # Matrix A| 2 0 3 6 0 0 7 0 3 1 0 0 C| 1 4 4 0 0 0 0 5 4 1 3 2 G| 4 2 0 1 7 7 0 0 0 0 1 3 T| 0 1 0 0 0 0 0 2 0 5 3 2 # Construction Info Meme was run on the footprints with fixed width 12 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "1372245" "1640455" "12128207" # Footprints TCGCAGGACCTTCT CATGGCCAGGACCTCCTCATGGTCCTGCCGAGCA TGCTCCGGGTCCTGCTCCTCCG AATGGACGTTATCCTTATTA AGTTGCCAGGACCTCGGATA TGCCTGCAAGGACATTTCGCC TGCGCAGGGATATTTATGCGC # Name twi # Matrix A| 1 3 1 0 11 0 7 0 0 1 1 2 C| 4 7 3 14 3 4 1 0 0 0 2 3 G| 3 3 10 1 1 1 5 0 12 2 2 8 T| 7 2 1 0 0 10 2 15 3 12 10 2 # Construction Info Meme was run on the footprints with fixed width 12 and flanking sequence was added for footprints less than 9bp or the fixed width. # Pubmed Ids for Footprinted Sites "1644293" "1325394" "9840810" "8404855" "8601485" "9211899" "9362473" # Footprints GTCGCCATTTGGTGG ACTCGCACGTGTGCG CTCGCATATGTTG TGAGCACATGTTT CCCCGGCATATGTTACG GCTTCCCACCTGATAGG CAGGACAGCGTGTGTTCTGG TGCACACATTTCT ATCACCATCGGCTCTGGAAC TTTCTCATGTGTTGCTCAGC TGTGTTGCCTTTTTCCGCTT TCAAAACAGCCGTCGGCCATT ATGTACATATGCACTACATATGCAATTATATACATATGT TGGGCTGGTCAACATGTGTGATTCGCATGTGTGGA ATGCAACATATGGCGGCCATATACGAGA # Name Ubx # Matrix A| 13 31 54 0 3 49 C| 26 19 0 0 2 0 G| 5 0 0 0 0 0 T| 12 6 2 56 51 7 # Construction Info Meme was run on the footprints with fixed width 6 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "7906203" "7915199" "7821226" "1673656" "12070087" "7555708" "10628847" "1358457" "8096172" "3215512" "2904838" # Footprints TTGATGTCTCC AGTAATGCGACCATTAC GCTAATGATG AGTACTACCCATTTGGC CCCATTTCG TCCCCATGCCCATTT GTTTGTTTTAT TATCAATTAG ACCCAATTAGTAATAAAT TGGCCATTAA ACCATTACCATTACCATTATCATTACCGTTACTATTACCATTA GCTTTTTAATAAGTT CTTTTATAATGTGCCCGTCTTAATATGAT ATTTTAATTACCAAC AATAATATTAATTAT CGGAGCATTATAAAAGTTTAATTGATT TAATGATAATTACAAAC TGATAATTGACTTT TGAAACACATAAATCTTAAGTG ACATCATAAAAATATTAAAAA AGCTTCATAATTGC CCAATTAAATTTGATGATCTTGC AAATTAAATC TCAATTATGCGCAATTTTGC CCATAGAAAATGATAAATGGCGGC GCAAATAATTTATTATCCA GTAATTATACAAGTTAATGTTAG TGCATTTAAAAGTAAATTT CTCATATTAAATGGACGTTATG AACAGATTATGGATTAG TTACCTTAATTGCTTATATATTA TGTTCATTAAATAAAATAATTT TGAATTAGTTA TGAAATAATTTT TAGGATAAATTGTTATTATAAATTT AGTAATATTCGAAATAATAATTACATTCA GGGCATAAATTAAATACACA TTGAAAGCAATAAAGAAA TAAATAATAGTTGTGG ATAATTAAATAAT GCCGATAATTGCTGCCATGAATATATAATAAT CAACATAATCACAAAAATTACC GAAATACAAAT CGGTATGGCTTCATTACGCCG CCTTTGCATATATTTAAGCACTAATTGCGTGAAGCCATAAATCTAAA CATTTAATGCATTT TGATTAAAAATCAACATACGACAATC ACCATCTTTAATAATATTT GTTAATTTAATTTATTTC GCACATTTAACATCCATTAAG ATCCCTAATGCACTTCC CCTGCGATTACAATTACGATTACGGTTACGATTACGGTTATTATTATAATAATGGGTTTATGACGATCT GCGGTTCTAATTTTTTACGATTATTGTTATGATTATTTTTACGGCCTTTATGATCTTAGCGGGC ATATAATATAATAATAAAAATAATAATAATAATAATAATATAATATATACTAATAGTATATAATAATTTTAATAGTATGTTATA CGTAAGCGTTACGATTATTACTATGTTTATTGTTATTGCAATTATTATTATTATTTTTATGGTTTTAACGATTTGAACGATTATTAGCCATAG GGCCAATAATAACAATAATGCCGCTGATAATGTGGATAATAAAACAAAG # Name vnd # Matrix A| 1 0 2 0 0 0 0 3 1 1 C| 0 3 0 3 0 0 1 0 0 2 G| 2 0 0 0 0 0 2 0 2 0 T| 0 0 1 0 3 3 0 0 0 0 # Construction Info Meme was run on the footprints with fixed width 10 and flanking sequence was added for footprints less than 9bp or the fixed width. # Pubmed Ids for Footprinted Sites "9832510" # Footprints CAGCACTTGAAA GCTCTTCAGCTCAAGTG GCACACTTGAGC # Name vvl # Matrix A| 0 11 2 0 3 11 C| 2 0 2 0 8 0 G| 0 0 0 6 0 0 T| 9 0 7 5 0 0 # Construction Info Meme was run on the footprints with fixed width 6 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "10862753" "8657157" "9012536" # Footprints CATCGTCATCAGCATGCATGGCA GTCGCTAATGATATGCACCCCT GCATTATGCAAATGTTCC TGAATAAATTAAAACC CGTGTGCATACATACATAAATCGG GATTATACTAAAAATTAATTTTGAAATAATT ATAACTTTATTAT TTTAATTGATTAAAATGC TGAATGTTAATTA TCCAGCTCATTACGAAGG GATTTTTGCATATC # Name zen # Matrix A| 1 12 3 0 7 10 8 5 2 0 C| 10 0 1 0 0 0 0 3 1 1 G| 1 0 0 0 0 0 0 2 0 2 T| 0 0 8 12 5 2 4 2 9 9 # Construction Info Meme was run on the footprints with fixed width 10 and flanking sequence was not added and so footprints less than 9bp or the fixed width were excluded. # Pubmed Ids for Footprinted Sites "9053307" "2895896" "1968224" "2569362" "7905482" # Footprints GGAGATAAGTGCCCATTAGTT CATATTAATGATCTTCCA CCGATCTCGCATTAAAAATAAATAATG AAAGCTAATTGTTTTAATTTAAATGAA CTTCAATTAACCAGTTAAATGTG CGAAATTGATTGATATTTAATTGACATTTAATTTATT AACATTAAAATTAATAAATTATTACAAAATGACAATACATTAACGC CAGCTTTAATCATTCCTC CTGAAATAAATTTACTTTAAT GTTACGATTATTACTATGTTTATTGTTATTGCAATTATTATTATTATTTTTATGGTTTTAACGATTTGAACGATTATTAGCCATAGT GGGCCAATAATAACAATAATGCCGCTGATAATGTGGATAATAAAACAA AACTTAATCCCAAATTGCAATTTTATTATTAAGT # Name z # Matrix A| 11 1 1 41 1 8 2 18 10 14 C| 3 7 0 0 0 10 6 7 5 6 G| 5 3 40 0 40 0 29 11 12 2 T| 22 30 0 0 0 23 4 5 14 19 # Construction Info Meme was run on the footprints with fixed width 10 and flanking sequence was added for footprints less than 9bp or the fixed width. # Pubmed Ids for Footprinted Sites "3145199" "2501151" "3131017" "12853632" # Footprints TATTCGAGTGAAA TTATTGAGCGGCG AAGCGACTCAATT ATGAGTGCACTCA ACTTTGAGTGGAA ATTTTGAGTGAGA AAGCTGAGTGGCT AGGTTGAGTGGGA GTTTCACTCATTT TTTTCGCTCAGTG TGGTTGAGTGGAG CTAACTCACTCAAATGC TATTGTCACTCGCCTGT AAACCACTCAAAA TGGTTGAGTGTGT CGGCCACTCAAGA GAGACCCGCTCACGCAC GAGAAACGCTCAAGTTCAC GATTGGAGTGCTT TCGAGTGAGTG TTATATCTCATTT GCCGACTCAACTCACTC GCCTAAAAACGAGTGGAAAA CAGCGAAACGCTCAAA TGTTTTTGAGCGCTCT CTCTCTCTTGAGTGTTC GCGCCAACGTAACGATCTCGTTTCCA AGCGAGAGCTTTTCATAG GAGCAAGGCGAAAGAGAGCA AAACAATTGAGACAAACCAT GAGAGGGAGAGATACGGTT CTGTATCTCGCTCTTACGCACG CTTTTTGAGTTATCGGCAC GTTTTATGGCTCATTTT ATTTTGAGTGCGTTCTTCC GCCTTGCGGTGACAAATTGCTCCGGCAACAGAA ACTTTGGATGCACTCATAAAAAAACT ATAAAGGCTCATGAAAGTCTCGTTTTAAATA ATGTATCTATGAGTCAGTTCT CCTGCAAGTTTTTTAAGAAATTTTCGAGTT CTCTTATGAGATAATTCACGAT